• Creator: robertjamesd220
• Population: 3
• Generation: 21
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2021
• Genome: GGGCGGAACGAAACTCGATTCCTGTTTCAGTGT
• Function:

  exp(square(numbers('rep') if 2 *(mod(numbers('rep'), numbers('epe'))) > numbers('epe') else mod(numbers('rep'), numbers('epe'))), mod(numbers('rep'), numbers('epe')) if numbers('epe') > 2 *(mod(numbers('rep'), numbers('epe'))) else numbers('rep')) if square(numbers('rep') if 2 *(mod(numbers('rep'), numbers('epe'))) > mod(numbers('rep'), numbers('epe')) else numbers('epe')) > numbers('rep') if 2 *(mod(numbers('rep'), numbers('epe'))) > mod(numbers('rep'), numbers('epe')) else numbers('epe') else 2 *(mod(numbers('rep'), numbers('epe')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.