• Creator: guest79
• Population: 0
• Generation: 10
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: ATGATGCTTCCGGGCACACCGGCTTATTTACCT
• Function:

  sqrt(sqrt(round(divide(numbers('yxy') if numbers('xyy') > numbers("yxx") else gradient[2](numbers('yxy')), gradient[2](numbers('yxy'))), numbers('xyy') if numbers("yxx") > numbers('yxy') else gradient[2](numbers('yxy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.