• Creator: guest79
• Population: 0
• Generation: 16
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: GACAACATACTCATTAAATATGTCGTTTTCCCT
• Function:

  logn(min(gradient[0](abs(numbers("yxx"))), abs(numbers("yxx")))) if square(logn(min(gradient[0](abs(numbers("yxx"))), abs(numbers("yxx"))))) > min(gradient[0](abs(numbers("yxx"))), abs(numbers("yxx"))) else gradient[0](abs(numbers("yxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.