• Creator: aretelicy
• Population: 0
• Generation: 0
• Total Fitness: 9
• No. Votes: 1
• Avg. Fitness 9
• Created: 11/11/2021
• Genome: GCACGAGCGATTACGCGCTAGGGCCACGGC
• Function:

  numbers('xry') if numbers("xyx") > gradient[0](100 *(numbers('xry'))) else 100 *(numbers('xry')) if 100 *(numbers('xry')) > gradient[0](100 *(numbers('xry'))) else mod(numbers("xyx") if gradient[0](100 *(numbers('xry'))) > numbers('xry') else 100 *(numbers('xry')), gradient[0](100 *(numbers('xry'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.