• Creator: guest79
• Population: 0
• Generation: 20
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: GACAGGCCTGTAACCCCAAAATAGGCCTTG
• Function:

  numbers("xxx") if 10 *(numbers("yyy")) > numbers("xyx") else numbers("yyy") if divide(numbers("xxx") if 10 *(numbers("yyy")) > numbers("xyx") else numbers("yyy"), 10 *(numbers("yyy"))) > 10 *(numbers("yyy")) else tan(divide(10 *(numbers("yyy")) if numbers("yyy") > numbers("xyx") else numbers("xxx"), 10 *(numbers("yyy"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.