• Creator: guest145
• Population: 0
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: ATGCCCGAGCGCATTTAGTTTTACTTAGCA
• Function:

  sqrt(product(numbers('rrr') if round(gradient[0](numbers("xyx")), numbers("xyx")) > numbers("xyx") else gradient[0](numbers("xyx")), round(gradient[0](numbers("xyx")), numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.