• Creator: guest6177
• Population: 0
• Generation: 9
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 09/14/2022
• Genome: TCCTACGGTACTAGCGTCCTACTAGCCGTG
• Function:

  2 *(cos(numbers('rep'))) if cos(numbers('rep')) > 2 *(cos(numbers('rep'))) if cos(numbers('rep')) > numbers('rep') else numbers("per") else cos(numbers('rep')) if cos(numbers('rep')) if numbers('rep') > numbers("per") else 2 *(cos(numbers('rep'))) > numbers('rep') else 2 *(cos(numbers('rep')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.