• Creator: guest164
• Population: 0
• Generation: 0
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: TTCTCACCTACTCTTTATTCTGCCGGTAAT
• Function:

  divide(2 *(round(numbers("yxx"), numbers('xyy'))), round(numbers("yxx"), numbers('xyy'))) if 2 *(round(numbers("yxx"), numbers('xyy'))) > round(numbers("yxx"), numbers('xyy')) else 2 *(round(numbers("yxx"), numbers('xyy'))) if numbers("yxx") > round(numbers("yxx"), numbers('xyy')) else divide(2 *(round(numbers("yxx"), numbers('xyy'))), round(numbers("yxx"), numbers('xyy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.