• Creator: guest171
• Population: 0
• Generation: 3
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: TACCGCTCGACTATGACTCGGTGTTGCTAGGGT
• Function:

  round(numbers('yxr') if sqrt(2 *(numbers('yxr'))) > 2 *(sqrt(2 *(numbers('yxr')))) else 2 *(numbers('yxr')), 2 *(sqrt(2 *(numbers('yxr'))))) if 2 *(numbers('yxr')) if 2 *(sqrt(2 *(numbers('yxr')))) > numbers('yxr') else sqrt(2 *(numbers('yxr'))) > 2 *(sqrt(2 *(numbers('yxr')))) else sqrt(2 *(numbers('yxr')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.